After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFSF4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_053552.1
Размер кДНК:600bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor (ligand) superfamily, member 4 with N terminal Flag tag.
Синоним гена:Ox40l, Txgp1, Tnfsf4
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80146-ACGRBS15396
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80146-ACRRBS15396
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80146-CFRBS13343
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80146-CHRBS13343
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80146-CMRBS13343
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80146-CYRBS13343
Крыса OX-40L / TNFSF4 / CD252 Джин клон кДНК в вектор клонированияRG80146-GRBS5132
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80146-NFRBS13343
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80146-NHRBS13343
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80146-NMRBS13343
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80146-NYRBS13343
Крыса OX-40L / TNFSF4 / CD252 Джин ORF экспрессии кДНК клона плазмидыRG80146-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

OX-40L, also known as TNFSF4 and CD252, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. OX-40L is an important costimulatory molecule that plays a crucial role in the regulation of T-cell-mediated immunity. The interaction of TNFSF4-TNFSF4 is involved in the pathogenesis of multiple autoimmune and inflammatory diseases such as systemic lupus erythematosus (SLE), carotid artery disease and cancer. OX-40L is a ligand for receptor TNFRSF4/OX4. It is found to play a role in T cell antigen-presenting cell (APC) interactions. In surface Ig- and CD40-stimulated B cells, this cytokine along with CD70 has been shown to provide CD28-independent costimulatory signals to T cells. This protein and its receptor are reported to directly mediate adhesion of activated T cells to vascular endothelial cells.

Ссылки
  • Lei W. et al., 2012, Ann Acad Med Singapore. 41 (5): 200-4.
  • Lee YH. et al., 2012, Hum Immunol. 73 (10): 1050-4.
  • Weiguang Y. et al., 2012, PLoS One. 7 (8): e41277.
  • Size / Price
    Каталог: RG80146-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».