Быстрый заказ

Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFSF15 Информация о продукте «Клон cDNA»
Размер кДНК:759bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor (ligand) superfamily, member 15 with N terminal Flag tag.
Синоним гена:Tl1, Vegi, Tnfsf15
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80150-ACGRBS15400
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80150-ACRRBS15400
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80150-CFRBS13340
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80150-CHRBS13340
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80150-CMRBS13340
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80150-CYRBS13340
Крыса TL1A / TNFSF15 Джин клон кДНК в вектор клонированияRG80150-GRBS5130
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80150-NFRBS13340
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80150-NHRBS13340
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80150-NMRBS13340
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80150-NYRBS13340
Крыса TL1A / TNFSF15 Джин ORF экспрессии кДНК клона плазмидыRG80150-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TL1A, also known as TNFSF15, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. It is specifically expressed in endothelial cells. TL1A also can be detected in monocytes, placenta, lung, liver, kidney, skeletal muscle, pancreas, spleen, prostate, small intestine and colon. TL1A is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It mediates activation of NF-kappa-B. It also inhibits vascular endothelial growth and angiogenesis (in vitro). TL1A promotes activation of caspases and apoptosis. It is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor.

  • Jin T, et al. (2007) X-ray crystal structure of TNF ligand family member TL1A at 2.1A. Biochem Biophys Res Commun. 364(1):1-6.
  • Cassatella MA, et al. (2007) Soluble TNF-like cytokine (TL1A) production by immune complexes stimulated monocytes in rheumatoid arthritis. J Immunol. 178(11):7325-33
  • Prehn JL, et al. (2007) The T cell costimulator TL1A is induced by FcgammaR signaling in human monocytes and dendritic cells. J Immunol. 178(7):4033-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.