After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFSF12 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001001513.2
Размер кДНК:750bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor ligand superfamily member 12 with N terminal Flag tag.
Синоним гена:TWEAK, Prmt2, Tnfsf12
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80154-ACGRBS15400
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80154-ACRRBS15400
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80154-CFRBS13340
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80154-CHRBS13340
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80154-CMRBS13340
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80154-CYRBS13340
Крыса TNFSF12 Джин клон кДНК в вектор клонированияRG80154-GRBS5130
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80154-NFRBS13340
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80154-NHRBS13340
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80154-NMRBS13340
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80154-NYRBS13340
Крыса TNFSF12 Джин ORF экспрессии кДНК клона плазмидыRG80154-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TNFSF12 is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. It is a ligand for the FN14/TWEAKR receptor. TNFSF12 has overlapping signaling functions with TNF, but displays a much wider tissue distribution. It can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. It is also found that TNFSF12 promotes proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. TNFSF12 also is a weak inducer of apoptosis in some cell types and mediates NF-kappa-B activation.

Ссылки
  • Wiley SR, et al. (2004) TWEAK, a member of the TNF superfamily, is a multifunctional cytokine that binds the TweakR/Fn14 receptor. Cytokine Growth Factor Rev. 14(3-4):241-9.
  • Campbell S, et al. (2006) The role of TWEAK/Fn14 in the pathogenesis of inflammation and systemic autoimmunity. Front Biosci. 9:2273-84.
  • Lynch CN, et al. (1999) TWEAK induces angiogenesis and proliferation of endothelial cells. J Biol Chem. 274(13):8455-9.
  • Size / Price
    Каталог: RG80154-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».