After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFSF11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_057149.1
Размер кДНК:957bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor (ligand) superfamily, member 11 with N terminal Flag tag.
Синоним гена:RANKL, Tnfsf11, Opgl, Trance
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80165-ACGRBS15400
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80165-ACRRBS15400
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80165-CFRBS13340
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80165-CHRBS13340
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80165-CMRBS13340
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80165-CYRBS13340
Крыса RANKL/OPGL/TNFSF11/CD254 Джин клон кДНК в вектор клонированияRG80165-GRBS5130
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80165-NFRBS13340
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80165-NHRBS13340
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80165-NMRBS13340
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80165-NYRBS13340
Крыса RANKL/OPGL/TNFSF11/CD254 Джин ORF экспрессии кДНК клона плазмидыRG80165-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tumor necrosis factor ligand superfamily member 11, also known as Receptor activator of nuclear factor kappa-B ligand, Osteoprotegerin ligand, TNFSF11, RANKL, TRANCE, OPGL and CD254, is a single-pass type II membrane protein which belongs to the tumor necrosis factor family. The receptor activator of nuclear factor-kappaB ligand (RANKL), its cognate receptor RANK, and its natural decoy receptor osteoprotegerin have been identified as the final effector molecules of osteoclastic bone resorption. RANK and RANKL are key regulators of bone remodeling and regulate T cell/dendritic cell communications, and lymph node formation. Moreover, RANKL and RANK are expressed in mammary gland epithelial cells and control the development of a lactating mammary gland during pregnancy. Genetically, RANKL and RANK are essential for the development and activation of osteoclasts and bone loss in response to virtually all triggers tested. Inhibition of RANKL function via the natural decoy receptor osteoprotegerin (OPG, TNFRSF11B) prevents bone loss in postmenopausal osteoporosis and cancer metastases. Importantly, RANKL appears to be the pathogenetic principle that causes bone and cartilage destruction in arthritis. RANK-RANKL signaling not only activates a variety of downstream signaling pathways required for osteoclast development, but crosstalk with other signaling pathways also fine-tunes bone homeostasis both in normal physiology and disease. In addition, RANKL and RANK have essential roles in lymph node formation, establishment of the thymic microenvironment, and development of a lactating mammary gland during pregnancy.

Ссылки
  • Takayanagi H, et al. (2002) Signaling crosstalk between RANKL and interferons in osteoclast differentiation. Arthritis Res. 4 Suppl 3: S227-32.
  • Nakashima T, et al. (2003) RANKL and RANK as novel therapeutic targets for arthritis. Curr Opin Rheumatol. 15(3): 280-7.
  • Schwarz EM, et al. (2007) Clinical development of anti-RANKL therapy. Arthritis Res Ther. 9 Suppl 1: S7.
  • Leibbrandt A, et al. (2008) RANK/RANKL: regulators of immune responses and bone physiology. Ann N Y Acad Sci. 1143: 123-50.
  • Size / Price
    Каталог: RG80165-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».