Быстрый заказ

Text Size:AAA

Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFSF10 Информация о продукте «Клон cDNA»
Размер кДНК:864bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor (ligand) superfamily, member 10 with N terminal Flag tag.
Синоним гена:Trail, Tnfsf10
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80152-ACGRBS15400
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80152-ACRRBS15400
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80152-CFRBS13340
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80152-CHRBS13340
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80152-CMRBS13340
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80152-CYRBS13340
Крыса TRAIL/TNFSF10 Джин клон кДНК в вектор клонированияRG80152-GRBS5130
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80152-NFRBS13340
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80152-NHRBS13340
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80152-NMRBS13340
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80152-NYRBS13340
Крыса TRAIL/TNFSF10 Джин ORF экспрессии кДНК клона плазмидыRG80152-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tumor necrosis factor ligand superfamily member 10 (TNFSF10), also known as TNF-related apoptosis-inducing ligand (TRAIL), Apo-2 ligand, and CD253, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. TNFSF10 / Apo-2L / CD253 functions as a ligand that induces the process of cell death called apoptosis. TNFSF10 / TRAIL shows homology to other members of the tumor necrosis factor superfamily. As one member of the cluster of differentiation system, TNFSF10 / CD253 is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion TNFSF10 / Apo-2L / CD253 / TRAIL binds to several members of TNF receptor superfamily including TNFRSF10A / TRAILR1, TNFRSF10B / TRAILR2, TNFRSF10C / TRAILR3, TNFRSF10D / TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of TNFSF10 / TRAIL may be modulated by binding to the decoy receptors TNFRSF10C / TRAILR3, TNFRSF10D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8 / JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

  • Song C, et al. (2005) TRAIL (CD253), a new member of the TNF superfamily. J Biol Regul Homeost Agents. 19(1-2): 73-7.
  • Kuribayashi K, et al. (2008) TNFSF10 (TRAIL), a p53 target gene that mediates p53-dependent cell death. Cancer Biol Ther. 7(12): 2034-8.
  • Wiley SR, et al. (1995) Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity. 3(6): 673-82.
  • Size / Price
    Каталог: RG80152-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.