After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFRSF19 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001044229.2
Размер кДНК:1251bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 19 with N terminal Flag tag.
Синоним гена:RGD1564996, Tnfrsf19
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80167-ACGRBS15400
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80167-ACRRBS15400
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80167-CFRBS13340
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80167-CHRBS13340
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80167-CMRBS13340
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80167-CYRBS13340
Крыса TNFRSF19/TROY Джин клон кДНК в вектор клонированияRG80167-GRBS5130
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80167-NFRBS13340
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80167-NHRBS13340
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80167-NMRBS13340
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80167-NYRBS13340
Крыса TNFRSF19/TROY Джин ORF экспрессии кДНК клона плазмидыRG80167-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), also known as TAJ-alpha or TROY, is a member of the TNF-receptor superfamily. TNFRSF19/TROY expression is detected in the pulmonary epithelium and the ductal epithelium of the prostate and parotid glands. TNFRSF19/TROY expression is detected in some adenocarcinoma cell lines that arise from this tissue. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. TNFRSF19/TROY is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. TNFRSF19/TROY was negatively regulated by adipogenic transcription factor CCAAT/enhancer-binding proteins (C/EBP). TNFRSF19 signals activation of the Jnk pathway and induces cell death. Overexpression of TNFRSF19 also signals NFB activation, comparable and similar to that by p75NGFR. TNFRSF19/TROY is capable of activating key signaling pathways of the TNF receptor family, and its predominant expression patterns suggest that it plays a role in the growth and regulation of epithelial tissues.

Ссылки
  • Hu S, et al. (1999) Characterization of TNFRSF19, a novel member of the tumor necrosis factor receptor superfamily. Genomics. 62(1): 103-7.
  • Qiu W, et al. (2010) Tumor necrosis factor receptor superfamily member 19 (TNFRSF19) regulates differentiation fate of human mesenchymal (stromal) stem cells through canonical Wnt signaling and C/EBP. J Biol Chem. 285(19): 14438-49.
  • Hisaoka T, et al. (2006) Characterization of TROY/TNFRSF19/TAJ-expressing cells in the adult mouse forebrain. Brain Res. 1110(1): 81-94.
  • Size / Price
    Каталог: RG80167-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».