Быстрый заказ

Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса TNFRSF18 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001024349.1
    Размер кДНК:366bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 18 with N terminal Flag tag.
    Синоним гена:Tnfrsf18
    Виды:Rat
    переносчик:pCMV3-SP-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TNFRSF18 qPCR primers for gene expression analysis, RP300184 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80192-ACGRBS15400
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80192-ACRRBS15400
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80192-CFRBS13340
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80192-CHRBS13340
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80192-CMRBS13340
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80192-CYRBS13340
    Крыса GITR/TNFRSF18/CD357 Джин клон кДНК в вектор клонированияRG80192-GRBS5130
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80192-NFRBS13340
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80192-NHRBS13340
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80192-NMRBS13340
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80192-NYRBS13340
    Крыса GITR/TNFRSF18/CD357 Джин ORF экспрессии кДНК клона плазмидыRG80192-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    GITR, also known as TNFRSF18(CD357), belongs to the tumor necrosis factor receptor (TNF-R) superfamily. It is the receptor for TNFSF18. GITR plays a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. GITR may be involved in interactions between activated T-lymphocytes and endothelial cells and in the regulation of T-cell receptor-mediated cell death. GITR and its ligand are important costimulatory molecules in the pathogenesis of autoimmune diseases. It also mediates NF-kappa-B activation via the TRAF2/NIK pathway.

    Immune Checkpoint
    Immune Checkpoint Detection: ELISA Antibodies
    Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Kwon B, et al. (1999) Identification of a novel activation-inducible protein of the tumor necrosis factor receptor superfamily and its ligand. J Biol Chem. 274(10):6056-61.
  • Nocentini G, et al. (1997) A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci. 94(12): 6216-21.
  • Baltz KM, et al. (2007) Cancer immunoediting by GITR (glucocorticoid-induced TNF-related protein) ligand in humans: NK cell/tumor cell interactions. FASEB J. 21(10):2442-54.
  • Size / Price
    Каталог: RG80192-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».