Быстрый заказ

Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFRSF14 Информация о продукте «Клон cDNA»
Размер кДНК:837bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 14 with N terminal HA tag.
Синоним гена:TNFRSF14
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80449-ACGRBS15400
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80449-ACRRBS15400
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80449-CFRBS13340
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80449-CHRBS13340
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80449-CMRBS13340
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80449-CYRBS13340
Крыса HVEM/TNFRSF14/CD270 Джин клон кДНК в вектор клонированияRG80449-GRBS5130
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80449-NFRBS13340
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80449-NHRBS13340
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80449-NMRBS13340
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80449-NYRBS13340
Крыса HVEM/TNFRSF14/CD270 Джин ORF экспрессии кДНК клона плазмидыRG80449-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Herpesvirus entry mediator (HVEM), also referred to as TNFRSF14, TR2 (TNF receptor-like molecule) and ATAR (another TRAF-associated receptor), is a member of type I transmembrane protein belonging to the TNF-receptor superfamily. It is expressed on many immune cells, including T and B cells, NK cells, monocytes, and neutrophils. Two TNF superfamily ligands lymphotoxin α (TNF-β) and LIGHT (TNFSF14) are identified as cellular ligands for HVEM and initiate the positive signaling. However, recent studies have revealed that HVEM is also involved in the unique inhibitory signaling pathway for T cells through activating tyrosine phosphorylation of the immunoreceptor tyrosine-based inhibitory motif (ITIM) in B and T lymphocyte attenuator (BTLA). HVEM provides a stimulatory signal following engagement with LIGHT (TNFSF14) on T cells. In contrast, it can also provide an inhibitory signal to T cells when it binds the B and T lymphocyte attenuator (BTLA), a ligand member of the Immunoglobulin (Ig) superfamily. Thus, HVEM may be viewed as a molecular switch, capable of facilitating both stimulatory and inhibitory cosignaling in T cells. Substantial evidence from both human disease and from experimental mouse models has indicated that dysregulation of the LIGHT-HVEM-BTLA cosignaling pathway can cause inflammation in the lung and in mucosal tissues.

  • Murphy KM, et al. (2006) Balancing co-stimulation and inhibition with BTLA and HVEM. Nat Rev Immunol. 6(9): 671-81.
  • Heo SK, et al. (2007) HVEM signaling in monocytes is mediated by intracellular calcium mobilization. J Immunol. 179(9): 6305-10.
  • Steinberg MW, et al. (2008) A crucial role for HVEM and BTLA in preventing intestinal inflammation. J Exp Med. 205(6): 1463-76.
  • Pasero C, et al. (2009) A role for HVEM, but not lymphotoxin-beta receptor, in LIGHT-induced tumor cell death and chemokine production. Eur J Immunol. 39(9): 2502-14.
  • Cheung TC. Modulation of T cell proliferation through the LIGHT-HVEM-BTLA cosignaling pathway. Recent Pat DNA Gene Seq. 3(3): 177-82.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.