Быстрый заказ

Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFRSF13B Информация о продукте «Клон cDNA»
Размер кДНК:738bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 13B with N terminal Flag tag.
Синоним гена:Tnfrsf13b
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80157-ACGRBS15400
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80157-ACRRBS15400
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80157-CFRBS13340
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80157-CHRBS13340
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80157-CMRBS13340
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80157-CYRBS13340
Крыса TACI/TNFRSF13B(CD267) Джин клон кДНК в вектор клонированияRG80157-GRBS5130
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80157-NFRBS13340
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80157-NHRBS13340
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80157-NMRBS13340
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80157-NYRBS13340
Крыса TACI/TNFRSF13B(CD267) Джин ORF экспрессии кДНК клона плазмидыRG80157-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tumor necrosis factor receptor superfamily, member 13B (TNFRSF13B) also known as Transmembrane activator and CAML interactor (TACI) and CD267 antigen, is a member of the tumor necrosis factor receptor superfamily. TNFRSF13B is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. TACI/TNFRSF13B/CD267 induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand.

  • Salzer U, et al. (2005) Mutations in TNFRSF13B encoding TACI are associated with common variable immunodeficiency in humans. Nat Genet. 37(8): 820-8.
  • Salzer U, et al. (2009) Relevance of biallelic versus monoallelic TNFRSF13B mutations in distinguishing disease-causing from risk-increasing TNFRSF13B variants in antibody deficiency syndromes. Blood. 113(9): 1967-76.
  • Mohammadi J, et al. (2009) Novel mutations in TACI (TNFRSF13B) causing common variable immunodeficiency. J Clin Immunol. 29(6): 777-85.
  • Size / Price
    Каталог: RG80157-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.