After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFRSF12A Информация о продукте «Клон cDNA»
Размер кДНК:390bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 12a with N terminal Flag tag.
Синоним гена:Fn14, MGC72653, Tnfrsf12a
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80164-ACGRBS15400
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80164-ACRRBS15400
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80164-CFRBS13340
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80164-CHRBS13340
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80164-CMRBS13340
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80164-CYRBS13340
Крыса TNFRSF12A/FN14/TWEAKR Джин клон кДНК в вектор клонированияRG80164-GRBS5130
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80164-NFRBS13340
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80164-NHRBS13340
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80164-NMRBS13340
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80164-NYRBS13340
Крыса TNFRSF12A/FN14/TWEAKR Джин ORF экспрессии кДНК клона плазмидыRG80164-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Fn14 (tumor necrosis factor receptor superfamily, member 12A), also known as TNFRSF12A, is the receptor for TNFSF12/TWEAK. Fn14 shares 82% amino acid identity with the mouse sequence. It contains a signal peptide, an extracellular domain, a membrane-anchoring domain, and a cytoplasmic domain. In response to FGF1, calf serum, or phorbol ester stimulation of human quiescent fibroblasts in vitro, the level of Fn14 is increased. A 1.2-kb FN14 transcript was expressed at high levels in heart, placenta, and kidney, at intermediate levels in lung, skeletal muscle, and pancreas, and at low levels in brain and liver. In addition, elevated FN14 expression was found in human liver cancer cell lines and hepatocellular carcinoma specimens. Expression of mouse Fn14 was upregulated in hepatocellular carcinoma nodules that develop in 2 different transgenic mouse models of hepatocarcinogenesis. TNFRSF12A is the weak inducer of apoptosis in some cell types. It promotes angiogenesis and the proliferation of endothelial cells. TNFRSF12A may modulate cellular adhesion to matrix proteins.

  • Burkly LC, et al. (2011) The TWEAK/Fn14 pathway in tissue remodeling: for better or for worse. Adv Exp Med Biol. 691:305-22.
  • Huang M, et al. (2011) Overexpression of Fn14 promotes androgen-independent prostate cancer progression through MMP-9 and correlates with poor treatment outcome. Carcinogenesis. 32(11):1589-96.
  • Dharmapatni AA, et al. (2011) TWEAK and Fn14 expression in the pathogenesis of joint inflammation and bone erosion in rheumatoid arthritis. Arthritis Res Ther. 13(2):R51.
  • Size / Price
    Каталог: RG80164-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.