After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFRSF11B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012870.2
Размер кДНК:1206bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 11b with N terminal Flag tag.
Синоним гена:Opg, MGC93568, Tnfrsf11b
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80159-ACGRBS15400
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80159-ACRRBS15400
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80159-CFRBS13340
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80159-CHRBS13340
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80159-CMRBS13340
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80159-CYRBS13340
Крыса Osteoprotegerin/TNFRSF11B Джин клон кДНК в вектор клонированияRG80159-GRBS5130
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80159-NFRBS13340
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80159-NHRBS13340
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80159-NMRBS13340
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80159-NYRBS13340
Крыса Osteoprotegerin/TNFRSF11B Джин ORF экспрессии кДНК клона плазмидыRG80159-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Osteoprotegerin or TNFRSF11B is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. Osteoprotegerin/TNFRSF11B acts as decoy receptor for RANKL and thereby neutralizes its function in osteoclastogenesis. This protein may inhibit the activation of osteoclasts and promotes osteoclast apoptosis in vitro. Bone homeostasis seems to depend on the local RANKL/OPG ratio. Osteoprotegerin/TNFRSF11B also play a role in preventing arterial calcification, act as decoy receptor for TRAIL and protect against apoptosis. TRAIL binding blocks the inhibition of osteoclastogenesis.

Ссылки
  • Collin-Osdoby P. (2005) Regulation of vascular calcification by osteoclast regulatory factors RANKL and osteoprotegerin. Circ Res. 95 (11): 1046-57.
  • Boyce BF, et al. (2007) Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res. Ther. 9 Suppl 1: S1.
  • Blázquez-Medela AM, et al. ( 2011) Osteoprotegerin and diabetes-associated pathologies. Curr Mol Med. 11 (5): 401-16.
  • Size / Price
    Каталог: RG80159-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».