RANK / TNFRSF11A cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Price:
Size:
Number:

RANK / TNFRSF11A cDNA ORF Clone, Rat, N-DDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1902 bp
Description
Full length Clone DNA of Rat Tumor necrosis factor receptor superfamily, member 11a with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RANK / TNFRSF11A cDNA ORF Clone, Rat, N-DDK (Flag®) tag: Alternative Names

TNFRSF11A cDNA ORF Clone, Rat

RANK / TNFRSF11A Background Information

TNFRSF11A is a member of the TNF-receptor superfamily. In mouse, it is also known as CD265. TNFRSF11A contains 4 TNFR-Cys repeats and is widely expressed with high levels in skeletal muscle, thymus, liver, colon, small intestine and adrenal gland. It is an essential mediator for osteoclast and lymph node development. TNFRSF11A and its ligand are important regulators of the interaction between T cells and dendritic cells. It can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. Defects in TNFRSF11A can cause familial expansile osteolysis (FEO). FEO is a rare autosomal dominant bone disorder characterized by focal areas of increased bone remodeling. Defects in TNFRSF11A also can cause Paget disease of bone type 2 (PDB2). PDB2 is a bone-remodeling disorder with clinical similarities to FEO. Defects in TNFRSF11A are the cause of osteopetrosis autosomal recessive type 7 which characterized by abnormally dense bone, due to defective resorption of immature bone.
Full Name
tumor necrosis factor receptor superfamily member 11a
References
  • Darnay B G, et al. (1998) Characterization of the intracellular domain of receptor activator of NF-kappaB (RANK). Interaction with tumor necrosis factor receptor-associated factors and activation of NF-kappab and c-Jun N-terminal kinase. J Biol Chem. 273(32):20551-5.
  • Darnay B G, et al. (1999) Activation of NF-kappaB by RANK requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-kappaB-inducing kinase. Identification of a novel TRAF6 interaction motif. J Biol Chem. 274(12):7724-31.
  • Galibert L, et al. (1998) The involvement of multiple tumor necrosis factor receptor (TNFR)-associated factors in the signaling mechanisms of receptor activator of NF-kappaB, a member of the TNFR superfamily. J Biol Chem. 273(51):34120-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait