Быстрый заказ

Text Size:AAA

Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TNFRSF11A Информация о продукте «Клон cDNA»
Размер кДНК:1902bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Tumor necrosis factor receptor superfamily, member 11a with N terminal Flag tag.
Синоним гена:RGD1563614, Tnfrsf11a
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80160-ACGRBS16760
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80160-ACRRBS16760
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80160-CFRBS14710
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80160-CHRBS14710
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80160-CMRBS14710
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80160-CYRBS14710
Крыса TNFRSF11A Джин клон кДНК в вектор клонированияRG80160-GRBS5130
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80160-NFRBS14710
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80160-NHRBS14710
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80160-NMRBS14710
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80160-NYRBS14710
Крыса TNFRSF11A Джин ORF экспрессии кДНК клона плазмидыRG80160-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TNFRSF11A is a member of the TNF-receptor superfamily. In mouse, it is also known as CD265. TNFRSF11A contains 4 TNFR-Cys repeats and is widely expressed with high levels in skeletal muscle, thymus, liver, colon, small intestine and adrenal gland. It is an essential mediator for osteoclast and lymph node development. TNFRSF11A and its ligand are important regulators of the interaction between T cells and dendritic cells. It can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. Defects in TNFRSF11A can cause familial expansile osteolysis (FEO). FEO is a rare autosomal dominant bone disorder characterized by focal areas of increased bone remodeling. Defects in TNFRSF11A also can cause Paget disease of bone type 2 (PDB2). PDB2 is a bone-remodeling disorder with clinical similarities to FEO. Defects in TNFRSF11A are the cause of osteopetrosis autosomal recessive type 7 which characterized by abnormally dense bone, due to defective resorption of immature bone.

  • Darnay B G, et al. (1998) Characterization of the intracellular domain of receptor activator of NF-kappaB (RANK). Interaction with tumor necrosis factor receptor-associated factors and activation of NF-kappab and c-Jun N-terminal kinase. J Biol Chem. 273(32):20551-5.
  • Darnay B G, et al. (1999) Activation of NF-kappaB by RANK requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-kappaB-inducing kinase. Identification of a novel TRAF6 interaction motif. J Biol Chem. 274(12):7724-31.
  • Galibert L, et al. (1998) The involvement of multiple tumor necrosis factor receptor (TNFR)-associated factors in the signaling mechanisms of receptor activator of NF-kappaB, a member of the TNFR superfamily. J Biol Chem. 273(51):34120-7.
  • Size / Price
    Каталог: RG80160-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.