Быстрый заказ

Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TMEM97 Информация о продукте «Клон cDNA»
Размер кДНК:531bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus transmembrane protein 97 with C terminal Flag tag.
Синоним гена:RGD1307423
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81128-ACGRBS15400
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81128-ACRRBS15396
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81128-ANGRBS15400
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81128-ANRRBS15396
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81128-CFRBS13340
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81128-CHRBS13340
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81128-CMRBS13340
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81128-CYRBS13340
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81128-NFRBS13343
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81128-NHRBS13340
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81128-NMRBS13340
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81128-NYRBS13340
Крыса TMEM97 Джин клон кДНК в вектор клонированияRG81128-URBS5130
Крыса TMEM97 Джин ORF экспрессии кДНК клона плазмидыRG81128-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81128-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.