Быстрый заказ

Text Size:AAA

Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TMEM204 Информация о продукте «Клон cDNA»
Размер кДНК:681bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus transmembrane protein 204 with C terminal His tag.
Синоним гена:Tmem204
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81630-ACGRBS15400
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81630-ACRRBS15400
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81630-ANGRBS15400
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81630-ANRRBS15400
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81630-CFRBS13340
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81630-CHRBS13340
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81630-CMRBS13340
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81630-CYRBS13340
Крыса TMEM204 Джин клон кДНК в вектор клонированияRG81630-GRBS5130
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81630-NFRBS13340
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81630-NHRBS13340
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81630-NMRBS13340
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81630-NYRBS13340
Крыса TMEM204 Джин ORF экспрессии кДНК клона плазмидыRG81630-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81630-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.