After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TIMM17B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001108249.1
Размер кДНК:519bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus translocase of inner mitochondrial membrane 17 homolog B (yeast) with N terminal Myc tag.
Синоним гена:Timm17b
Виды:Rat
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80720-ACGRBS15400
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80720-ACRRBS15400
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80720-CFRBS13340
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80720-CHRBS13340
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80720-CMRBS13340
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80720-CYRBS13340
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80720-NFRBS13340
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80720-NHRBS13340
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80720-NMRBS13340
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80720-NYRBS13340
Крыса TIMM17B Джин клон кДНК в вектор клонированияRG80720-URBS5130
Крыса TIMM17B Джин ORF экспрессии кДНК клона плазмидыRG80720-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80720-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».