Быстрый заказ

Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса THBD Информация о продукте «Клон cDNA»
    Размер кДНК:1734bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus thrombomodulin with C terminal HA tag.
    Синоним гена:Thbd
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with THBD qPCR primers for gene expression analysis, RP300318 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80348-ACGRBS16760
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80348-ACRRBS16760
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80348-CFRBS14710
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80348-CHRBS14710
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80348-CMRBS14710
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80348-CYRBS14710
    Крыса Thrombomodulin / THBD Джин клон кДНК в вектор клонированияRG80348-GRBS5130
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80348-NFRBS14710
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80348-NHRBS14710
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80348-NMRBS14710
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80348-NYRBS14710
    Крыса Thrombomodulin / THBD Джин ORF экспрессии кДНК клона плазмидыRG80348-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Thrombomodulin, also known as THBD(CD141), is an integral membrane protein which reduces blood coagulation by converting thrombin to an anticoagulant enzyme from a procoagulant enzyme. Thrombomodulin is expressed on the surface of endothelial cells and serves as a cofactor for thrombin. It is also expressed on human mesothelial cell, monocyte and a dendritic cell subset. Thrombomodulin functions as a cofactor in the thrombin-induced activation of protein C in the anticoagulant pathway by forming a 1:1 stoichiometric complex with thrombin. Thrombomodulin also regulates C3b inactivation by factor I. Mutations in the thrombomodulin gene have also been reported to be associated with atypical hemolytic-uremic syndrome.

  • Dzionek A, et al. (2002) Plasmacytoid dendritic cells: from specific surface markers to specific cellular functions. Hum Immunol. 63(12):1133-48.
  • Dzionek A, et al. (2000) BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol. 165(11):6037-46.
  • Wen DZ, et al. (1987) Human thrombomodulin: complete cDNA sequence and chromosome localization of the gene. Biochemistry. 26(14):4350-7.
  • Size / Price
    Каталог: RG80348-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.