After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TCEAL7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001109401.1
Размер кДНК:297bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus transcription elongation factor A (SII)-like 7.
Синоним гена:Tceal7
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81020-ACGRBS15396
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81020-ACRRBS15396
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81020-ANGRBS15396
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81020-ANRRBS15396
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81020-CFRBS13343
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81020-CHRBS13343
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81020-CMRBS13343
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81020-CYRBS13343
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81020-NFRBS13343
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81020-NHRBS13343
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81020-NMRBS13343
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81020-NYRBS13343
Крыса TCEAL7 Джин клон кДНК в вектор клонированияRG81020-URBS5132
Крыса TCEAL7 Джин ORF экспрессии кДНК клона плазмидыRG81020-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81020-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».