After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat TAF9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_184048.2
Размер кДНК:795bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor with N terminal Myc tag.
Синоним гена:Ak6, TAFII31
Виды:Rat
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80698-ACGRBS15400
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80698-ACRRBS15400
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80698-ANGRBS15400
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80698-ANRRBS15400
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80698-CFRBS13340
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80698-CHRBS13340
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80698-CMRBS13340
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80698-CYRBS13340
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80698-NFRBS13340
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80698-NHRBS13340
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80698-NMRBS13340
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80698-NYRBS13340
Крыса TAF9 Джин клон кДНК в вектор клонированияRG80698-URBS5130
Крыса TAF9 Джин ORF экспрессии кДНК клона плазмидыRG80698-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80698-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».