After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SSR3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031120.2
Размер кДНК:558bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus signal sequence receptor, gamma.
Синоним гена:Ssr3
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81016-ACGRBS15400
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81016-ACRRBS15400
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81016-CFRBS13340
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81016-CHRBS13340
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81016-CMRBS13340
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81016-CYRBS13340
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81016-NFRBS13340
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81016-NHRBS13340
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81016-NMRBS13340
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81016-NYRBS13340
Крыса SSR3 Джин клон кДНК в вектор клонированияRG81016-URBS5130
Крыса SSR3 Джин ORF экспрессии кДНК клона плазмидыRG81016-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81016-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».