Быстрый заказ

Text Size:AAA

Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SSR2 Информация о продукте «Клон cDNA»
Размер кДНК:552bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus signal sequence receptor, beta with C terminal His tag.
Синоним гена:Ssr2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81625-ACGRBS15396
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81625-ACRRBS15396
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81625-ANGRBS15396
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81625-ANRRBS15396
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81625-CFRBS13343
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81625-CHRBS13343
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81625-CMRBS13343
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81625-CYRBS13343
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81625-NFRBS13343
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81625-NHRBS13343
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81625-NMRBS13343
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81625-NYRBS13343
Крыса SSR2 Джин клон кДНК в вектор клонированияRG81625-URBS5132
Крыса SSR2 Джин ORF экспрессии кДНК клона плазмидыRG81625-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81625-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.