Быстрый заказ

Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса SPCS2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001191601.1
    Размер кДНК:681bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus signal peptidase complex subunit 2 homolog (S. cerevisiae).
    Синоним гена:RGD1311253
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SPCS2 qPCR primers for gene expression analysis, RP301019 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81055-ACGRBS15400
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81055-ACRRBS15400
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81055-CFRBS13340
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81055-CHRBS13340
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81055-CMRBS13340
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81055-CYRBS13340
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81055-NFRBS13340
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81055-NHRBS13340
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81055-NMRBS13340
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81055-NYRBS13340
    Крыса SPCS2 Джин клон кДНК в вектор клонированияRG81055-URBS5130
    Крыса SPCS2 Джин ORF экспрессии кДНК клона плазмидыRG81055-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81055-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».