After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SLC35A4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_147140.2
Размер кДНК:975bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus solute carrier family 35, member A4.
Синоним гена:Plrr4, Plrr-4
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81037-ACGRBS15400
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81037-ACRRBS15400
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81037-ANGRBS15400
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81037-ANRRBS15400
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81037-CFRBS13340
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81037-CHRBS13340
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81037-CMRBS13340
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81037-CYRBS13340
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81037-NFRBS13340
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81037-NHRBS13340
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81037-NMRBS13340
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81037-NYRBS13340
Крыса SLC35A4 Джин клон кДНК в вектор клонированияRG81037-URBS5130
Крыса SLC35A4 Джин ORF экспрессии кДНК клона плазмидыRG81037-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81037-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».