After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat SLC35A4 ORF mammalian expression plasmid, C-His tag

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SLC35A4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_147140.2
Размер кДНК:975bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus solute carrier family 35, member A4 with C terminal His tag.
Синоним гена:Plrr4, Plrr-4
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Каталог: RG81037-CH
Цена по прейскуранту:   (Save )
Цена:      [How to order]
Наличие2-3 weeksИнструкции по доставке
Изображения
      Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».