Быстрый заказ

Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса SLC31A1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_133600.1
    Размер кДНК:564bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus solute carrier family 31 (copper transporter), member 1 with N terminal His tag.
    Синоним гена:Ctr1, LRRGT00200
    Виды:Rat
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81631-ACGRBS15400
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81631-ACRRBS15400
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81631-ANGRBS15400
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81631-ANRRBS15400
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81631-CFRBS13340
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81631-CHRBS13340
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81631-CMRBS13340
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81631-CYRBS13340
    Крыса SLC31A1 Джин клон кДНК в вектор клонированияRG81631-GRBS5130
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81631-NFRBS13340
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81631-NHRBS13340
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81631-NMRBS13340
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81631-NYRBS13340
    Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмидыRG81631-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81631-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».