After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SLC31A1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133600.1
Размер кДНК:564bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus solute carrier family 31 (copper transporter), member 1 with C terminal His tag.
Синоним гена:Ctr1, LRRGT00200
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81631-ACGRBS15400
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81631-ACRRBS15400
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81631-ANGRBS15400
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81631-ANRRBS15400
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81631-CFRBS13340
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81631-CHRBS13340
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81631-CMRBS13340
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81631-CYRBS13340
Крыса SLC31A1 Джин клон кДНК в вектор клонированияRG81631-GRBS5130
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81631-NFRBS13340
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81631-NHRBS13340
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81631-NMRBS13340
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81631-NYRBS13340
Крыса SLC31A1 Джин ORF экспрессии кДНК клона плазмидыRG81631-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81631-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».