After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SLC25A39 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001024792.1
Размер кДНК:1080bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus solute carrier family 25, member 39.
Синоним гена:RGD1306193
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80999-ACGRBS15400
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80999-ACRRBS15400
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80999-ANGRBS15400
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80999-ANRRBS15400
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80999-CFRBS13340
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80999-CHRBS13340
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80999-CMRBS13340
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80999-CYRBS13340
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80999-NFRBS13340
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80999-NHRBS13340
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80999-NMRBS13340
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80999-NYRBS13340
Крыса SLC25A39 Джин клон кДНК в вектор клонированияRG80999-URBS5130
Крыса SLC25A39 Джин ORF экспрессии кДНК клона плазмидыRG80999-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80999-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».