Быстрый заказ

Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса SLC25A13 Информация о продукте «Клон cDNA»
    Размер кДНК:1473bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus solute carrier family 25 (aspartate/glutamate carrier), member 13 with C terminal His tag.
    Синоним гена:RGD1565889
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with SLC25A13 qPCR primers for gene expression analysis, RP301018 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81054-ACGRBS15400
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81054-ACRRBS15400
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81054-CFRBS13340
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81054-CHRBS13340
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81054-CMRBS13340
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81054-CYRBS13340
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81054-NFRBS13340
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81054-NHRBS13340
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81054-NMRBS13340
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81054-NYRBS13340
    Крыса SLC25A13 Джин клон кДНК в вектор клонированияRG81054-URBS5130
    Крыса SLC25A13 Джин ORF экспрессии кДНК клона плазмидыRG81054-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81054-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.