Быстрый заказ

Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SLAMF1 Информация о продукте «Клон cDNA»
Размер кДНК:1038bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus signaling lymphocytic activation molecule family member 1 with C terminal HA tag.
Синоним гена:RGD1560634, Slamf1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80349-ACGRBS15396
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80349-ACRRBS15396
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80349-CFRBS13343
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80349-CHRBS13343
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80349-CMRBS13343
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80349-CYRBS13343
Крыса CD150 / SLAM / SLAMF1 Джин клон кДНК в вектор клонированияRG80349-GRBS5132
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80349-NFRBS13343
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80349-NHRBS13343
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80349-NMRBS13343
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80349-NYRBS13343
Крыса CD150 / SLAM / SLAMF1 Джин ORF экспрессии кДНК клона плазмидыRG80349-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD150/signaling lymphocytic activation molecule (SLAM) is a cell surface sialylated phosphoglycoprotein and belongs to the CD2 subset of the Ig superfamily of type I transmembrane glycoproteins. The CD150 receptor is expressed on thymocytes, activated and memory T cells, B cells, platelets, natural killer T cells, and mature dendritic cells, and is also detected on tumor cells of Hodgkin's lymphoma (HL) and diffuse large B-cell lymphoma with an activated B cell phenotype. Additionally, it is the immune cell receptor for measles virus (MV). As a self-ligand, CD150 performs diverse immunologic functions including T/B-cell costimulation, induction of IFN-&gamma in Th1 T-cell clones, redirection of Th2 clones to a Th1 or Th0 phenotype, and inhibition of apoptosis in B cells. Furthermore, CD150 was shown to be the second receptor for measles virus in addition to CD46, and the distribution of SLAM on various cell lines is consistent with their susceptibility to clinical isolates of measles virus.

  • Tatsuo H, et al. (2002) The morbillivirus receptor SLAM (CD150). Microbiol Immunol. 46(3): 135-42.
  • Sidorenko SP, et al. (2003)The dual-function CD150 receptor subfamily: the viral attraction. Nat Immunol. 4(1): 19-24.
  • Yurchenko MY, et al. (2010) CD150 regulates JNK1/2 activation in normal and Hodgkin's lymphoma B cells. Immunol Cell Biol. 88(5): 565-74.
  • Leonard VH, et al. (2010) Measles virus selectively blind to signaling lymphocytic activation molecule (SLAM ; CD150) is attenuated and induces strong adaptive immune responses in rhesus monkeys. J Virol. 84(7): 3413-20.
  • Size / Price
    Каталог: RG80349-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.