After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SFTPD Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012878.2
Размер кДНК:1125bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus surfactant protein D.
Синоним гена:SPD, SP-D, Sftpd
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80256-ACGRBS15400
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80256-ACRRBS15400
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80256-CFRBS13340
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80256-CHRBS13340
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80256-CMRBS13340
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80256-CYRBS13340
Крыса SFTPD/SP-D Джин клон кДНК в вектор клонированияRG80256-GRBS5130
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80256-NFRBS13340
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80256-NHRBS13340
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80256-NMRBS13340
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80256-NYRBS13340
Крыса SFTPD/SP-D Джин ORF экспрессии кДНК клона плазмидыRG80256-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Surfactant pulmonary-associated protein D, also known as SFTPD and SP-D, is a member of the collectin family of C-type lectins that is synthesized in many tissues including respiratory epithelial cells in the lung, and contains one C-type lectin domain and one collagen-like domain. The polymorphic variation in the N-terminal domain of the SP-D molecule influences oligomerization, function, and the concentration of the molecule in serum. SFTPD is produced primarily by alveolar type II cells and nonciliated bronchiolar cells in the lung and is constitutively secreted into the alveoli where it influences surfactant homeostasis, effector cell functions, and host defense. It is upregulated in a variety of inflammatory and infectious conditions including Pneumocystis pneumonia and asthma. SFTPD is humoral molecules of the innate immune system, and is considered a functional candidate in chronic periodontitis. Besides it is involved in the development of acute and chronic inflammation of the lung. Several human lung diseases are characterized by decreased levels of bronchoalveolar SFTPD. Thus, recombinant SFTPD has been proposed as a therapeutical option for cystic fibrosis, neonatal lung disease and smoking-induced emphysema. Furthermore, SFTPD serum levels can be used as disease activity markers for interstitial lung diseases.

Ссылки
  • Leth-Larsen R, et al. (2005) A common polymorphism in the SFTPD gene influences assembly, function, and concentration of surfactant protein D. J Immunol. 174(3): 1532-8.
  • Moran AP, et al. (2005) Role of surfactant protein D (SP-D) in innate immunity in the gastric mucosa: evidence of interaction with Helicobacter pylori lipopolysaccharide. J Endotoxin Res. 11(6): 357-62.
  • Hartl D, et al. (2006) Surfactant protein D in human lung diseases. Eur J Clin Invest. 36(6): 423-35.
  • Krueger M, et al. (2006) Amino acid variants in Surfactant protein D are not associated with bronchial asthma. Pediatr Allergy Immunol. 17(1): 77-81.
  • Glas J, et al. (2008) Increased plasma concentration of surfactant protein D in chronic periodontitis independent of SFTPD genotype: potential role as a biomarker. Tissue Antigens. 72(1): 21-8.
  • Size / Price
    Каталог: RG80256-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».