After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SERPINF1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_177927.2
Размер кДНК:1257bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 with N terminal HA tag.
Синоним гена:Pedf, Dmrs91
Виды:Rat
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80481-ACGRBS15400
Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80481-ACRRBS15400
Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80481-CFRBS13340
Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80481-CHRBS13340
Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80481-CMRBS13340
Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80481-CYRBS13340
Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80481-NFRBS13340
Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80481-NHRBS13340
Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80481-NMRBS13340
Крыса PEDF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80481-NYRBS13340
Крыса PEDF Джин клон кДНК в вектор клонированияRG80481-URBS5130
Крыса PEDF Джин ORF экспрессии кДНК клона плазмидыRG80481-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Pigment epithelium-derived factor, also known as PEDF, Serpin F1, and SERPINF1, is a multiple functional protein which has both anti-angiogenic activity and neurotrophic activity at the same time. PEDF is a secreted glycoprotein that belongs to the noninhibitory serpin. It has an alpha/beta core serine-protease inhibitor domain, three major beta-sheets, and ten alpha-helices. PEDF does not inhibit either serine or cysteine proteinases. PEDF exerts diverse physiological activities including anti-angiogenesis, anti-vasopermeability, anti-tumor, and neurotrophic activities. PEDF acts via multiple high affinity ligands and cell receptors. It has been described as a natural angiogenesis inhibitor with neurotrophic and immune-modulation properties. PEDF induces macrophages apoptosis and necrosis through the activation of peroxisome proliferator-activated receptor-gamma by which PEDF could modulate inflammatory reactions in septic shock. It balances angiogenesis in the eye and blocks tumor progression.

Ссылки
  • Ren, JG. et al., 2005, Med Hypotheses. 64 (1): 74-8.
  • Filleur, S. et al., 2009. J Cell Biochem. 106 (5): 769-75.
  • Kawaguchi, T. et al., 2010, Curr Mol Med. 10 (3): 302-11.
  • Yamagishi, SI. et al., 2010, Curr Mol Med. 10 (3): 284-91.
  • Nakamura, T. et al., 2010, Curr Mol Med. 10 (3): 312-6.
  • Size / Price
    Каталог: RG80481-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».