After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SERPINE1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012620.1
Размер кДНК:1209bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 with N terminal HA tag.
Синоним гена:Pai1, PAI1A, Planh, Pai1aa, RATPAI1A
Виды:Rat
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80442-ACGRBS15400
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80442-ACRRBS15400
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80442-CFRBS13340
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80442-CHRBS13340
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80442-CMRBS13340
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80442-CYRBS13340
Крыса PAI-1 / SerpinE1 Джин клон кДНК в вектор клонированияRG80442-GRBS5130
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80442-NFRBS13340
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80442-NHRBS13340
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80442-NMRBS13340
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80442-NYRBS13340
Крыса PAI-1 / SerpinE1 Джин ORF экспрессии кДНК клона плазмидыRG80442-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Plasminogen activator inhibitor 1, also known as PAI-1, Endothelial plasminogen activator inhibitor, SerpinE1 and PLANH1, is a secreted glycoprotein which belongs to the serpin family. SerpinE1 is the primary physiological inhibitor of the two plasminogen activators urokinase (uPA) and tissue plasminogen activator (tPA). Its rapid interaction with TPA may function as a major control point in the regulation of fibrinolysis. Defects in SerpinE1 are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency) which is characterized by abnormal bleeding due to SerpinE1 defect in the plasma. High concentrations of SerpinE1 have been associated with thrombophilia which is an autosomal dominant disorder in which affected individuals are prone to develop serious spontaneous thrombosis. Studies of PAI-1 have contributed significantly to the elucidation of the protease inhibitory mechanism of serpins, which is based on a metastable native state becoming stabilised by insertion of the RCL into the central beta-sheet A and formation of covalent complexes with target proteases. Greater expression of PAI-1 has been associated with increased survival of cells and resistance to apoptosis. PAI-1 appears to influence apoptosis by decreasing cell adhesion (anoikis) as well as its effect on intracellular signaling. PAI-1, in its active state, also binds to the extracellular protein vitronectin. When in complex with its target proteases, it binds with high affinity to endocytosis receptors of the low density receptor family. The mechanisms of PAI-1 overexpression during obesity are complex, and it is conceivable that several inducers are involved at the same time at several sites of synthesis. PAI-1 is also implicated in adipose tissue development. It suggests that PAI-1 inhibitors serve in the control of atherothrombosis.

Ссылки
  • Alessi MC, et al. (2006) PAI-1 and the metabolic syndrome: links, causes, and consequences. Arterioscler Thromb Vasc Biol. 26(10): 2200-7.
  • Schneider DJ, et al. (2008) The effect of plasminogen activator inhibitor type 1 on apoptosis. Thromb Haemost. 100(6): 1037-40.
  • Dupont DM, et al. (2009) Biochemical properties of plasminogen activator inhibitor-1. Front Biosci. 14: 1337-61.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».