After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SERPINA11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001166352.1
Размер кДНК:1269bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11.
Синоним гена:Serpina11
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81027-ACGRBS15400
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81027-ACRRBS15400
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81027-CFRBS13340
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81027-CHRBS13340
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81027-CMRBS13340
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81027-CYRBS13340
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81027-NFRBS13340
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81027-NHRBS13340
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81027-NMRBS13340
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81027-NYRBS13340
Крыса SerpinA11 Джин клон кДНК в вектор клонированияRG81027-URBS5130
Крыса SerpinA11 Джин ORF экспрессии кДНК клона плазмидыRG81027-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified. Mouse Serpin A11, also known as SERPINA11, is a member of the serpin family.

Ссылки
  • Irving JA. et al., 2000, Genome Res. 10: 1845-64. 
  • Irving J. et al., 2002, Mol Biol Evol 19 (11): 1881-90.
  • Forsyth, S. et al., 2003, Genomics 81: 336-345. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-497.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Size / Price
    Каталог: RG81027-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».