After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SEMA7A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001108153.1
Размер кДНК:2001bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A with C terminal HA tag.
Синоним гена:Sema7a
Виды:Rat
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80345-ACGRBS16764
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80345-ACRRBS16764
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80345-CFRBS14710
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80345-CHRBS14710
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80345-CMRBS14710
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80345-CYRBS14710
Крыса SEMA7A Джин клон кДНК в вектор клонированияRG80345-GRBS5130
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80345-NFRBS14710
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80345-NHRBS14710
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80345-NMRBS14711
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80345-NYRBS14710
Крыса SEMA7A Джин ORF экспрессии кДНК клона плазмидыRG80345-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80345-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».