Semaphorin 4D cDNA ORF Clone, Rat, C-HA tag

Price:
Size:
Number:

Semaphorin 4D cDNA ORF Clone, Rat, C-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2589 bp
Description
Full length Clone DNA of Rat sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Semaphorin 4D Background Information

Semaphorin 4D (SEMA4D or CD1) is a member of the semaphorin family of proteins and an important mediator of the movement and differentiation of multiple cell types, including those of the immune, vascular, and nervous systems. VEGF and SEMA4D had a positive correlation with the malignant degree of ovarian cancer, and SEMA4D can serve as an independent prognostic factor. SEMA4D was the first semaphorin described to have immune functions and serves important roles in T cell priming, antibody production, and cell-to-cell adhesion. Proteolytic cleavage of SEMA4D from the cell surface gives rise to a soluble fragment of SEMA4D (sSEMA4D). Similar to the transmembranal form, sSEMA4D is thought to have immunoregulatory properties.
Full Name
semaphorin 4D
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait