After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SEMA4D Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001170563.1
Размер кДНК:2589bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D with N terminal His tag.
Синоним гена:Sema4d
Виды:Rat
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80320-ACGRBS22240
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80320-ACRRBS22240
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80320-CFRBS20190
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80320-CHRBS20190
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80320-CMRBS20190
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80320-CYRBS20190
Крыса Semaphorin 4D/SEMA4D/CD100 Джин клон кДНК в вектор клонированияRG80320-GRBS5130
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80320-NFRBS20190
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80320-NHRBS20190
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80320-NMRBS20190
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80320-NYRBS20190
Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмидыRG80320-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».