Быстрый заказ

Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса SEMA4D Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001170563.1
    Размер кДНК:2589bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D with N terminal His tag.
    Синоним гена:Sema4d
    Виды:Rat
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SEMA4D qPCR primers for gene expression analysis, RP300291 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80320-ACGRBS22240
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80320-ACRRBS22240
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80320-CFRBS20190
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80320-CHRBS20190
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80320-CMRBS20190
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80320-CYRBS20190
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин клон кДНК в вектор клонированияRG80320-GRBS5130
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80320-NFRBS20190
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80320-NHRBS20190
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80320-NMRBS20190
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80320-NYRBS20190
    Крыса Semaphorin 4D/SEMA4D/CD100 Джин ORF экспрессии кДНК клона плазмидыRG80320-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG80320-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».