P-Selectin cDNA ORF Clone, Rat, N-HA tag

Price:
Size:
Number:

P-Selectin cDNA ORF Clone, Rat, N-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2307 bp
Description
Full length Clone DNA of Rat selectinP with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

P-Selectin Background Information

P selectin (SELP) is a 14kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. SELP mediates rapid rolling of leukocyte rolling over vascular surfaces during the initial steps in inflammation through interaction with PSGL1. P selectin is a cell adhesion molecule on the surface of activated endothelial cells. Cellular adhesion molecules are a large family of proteins that attach the cytoskeleton and intracellular signaling cascades with the extracellular environment. SELP is a calcium-dependent receptor for myeloid cells that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interacton of activated endothelial cells or platelets with leukocytes.
Full Name
selectin P (granule membrane protein 140kDa, antigen CD62)
References
  • Johnson-Tidey RR, et al. (1994) Increase in the adhesion molecule P-selectin in endothelium overlying atherosclerotic plaques. Coexpression with intercellular adhesion molecule-1. Am J Pathol. 144(5):952-61.
  • Walcheck B, et al. (1996) Neutrophil-neutrophil interactions under hydrodynamic shear stress involve L-selectin and PSGL-1. A mechanism that amplifies initial leukocyte accumulation of P-selectin in vitro. J Clin Invest. 98(5):1081-7.
  • Foreman KE, et al. (1994) C5a-induced expression of P-selectin in endothelial cells. J Clin Invest. 94(3):1147-55.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait