Быстрый заказ

Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса SELP Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC101919.1
    Размер кДНК:2307bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus selectinP with N terminal HA tag.
    Синоним гена:PSELECT, MGC124632, Selp
    Виды:Rat
    переносчик:pCMV3-SP-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SELP qPCR primers for gene expression analysis, RP300418 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80451-ACGRBS16760
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80451-ACRRBS16760
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80451-CFRBS14710
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80451-CHRBS14710
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80451-CMRBS14710
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80451-CYRBS14710
    Крыса P-Selectin/CD62P/SELP Джин клон кДНК в вектор клонированияRG80451-GRBS5130
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80451-NFRBS14710
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80451-NHRBS14710
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80451-NMRBS14710
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80451-NYRBS14710
    Крыса P-Selectin/CD62P/SELP Джин ORF экспрессии кДНК клона плазмидыRG80451-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    P selectin (SELP) is a 140kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. SELP mediates rapid rolling of leukocyte rolling over vascular surfaces during the initial steps in inflammation through interaction with PSGL1. P selectin is a cell adhesion molecule on the surface of activated endothelial cells. Cellular adhesion molecules are a large family of proteins that attach the cytoskeleton and intracellular signaling cascades with the extracellular environment. SELP is a calcium-dependent receptor for myeloid cells that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interacton of activated endothelial cells or platelets with leukocytes.

    Ссылки
  • Johnson-Tidey RR, et al. (1994) Increase in the adhesion molecule P-selectin in endothelium overlying atherosclerotic plaques. Coexpression with intercellular adhesion molecule-1. Am J Pathol. 144(5):952-61.
  • Walcheck B, et al. (1996) Neutrophil-neutrophil interactions under hydrodynamic shear stress involve L-selectin and PSGL-1. A mechanism that amplifies initial leukocyte accumulation of P-selectin in vitro. J Clin Invest. 98(5):1081-7.
  • Foreman KE, et al. (1994) C5a-induced expression of P-selectin in endothelial cells. J Clin Invest. 94(3):1147-55.
  • Size / Price
    Каталог: RG80451-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».