After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SDHC Информация о продукте «Клон cDNA»
Размер кДНК:510bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus succinate dehydrogenase complex, subunit C, integral membrane protein with C terminal His tag.
Синоним гена:Sdhc
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81633-ACGRBS15400
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81633-ACRRBS15400
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81633-ANGRBS15400
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81633-ANRRBS15400
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81633-CFRBS13340
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81633-CHRBS13340
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81633-CMRBS13340
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81633-CYRBS13340
Крыса SDHC Джин клон кДНК в вектор клонированияRG81633-GRBS5130
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81633-NFRBS13340
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81633-NHRBS13340
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81633-NMRBS13340
Крыса SDHC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81633-NYRBS13340
Крыса SDHC Джин ORF экспрессии кДНК клона плазмидыRG81633-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81633-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.