After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat SDC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013026.2
Размер кДНК:942bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus syndecan 1 with C terminal HA tag.
Синоним гена:HSPG, Synd1, SYNDECA, Syndecan, Sdc1
Виды:Rat
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80344-ACGRBS15400
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80344-ACRRBS15400
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80344-CFRBS13340
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80344-CHRBS13340
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80344-CMRBS13340
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80344-CYRBS13340
Крыса Syndecan-1/CD138/SDC1 Джин клон кДНК в вектор клонированияRG80344-GRBS5130
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80344-NFRBS13340
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80344-NHRBS13340
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80344-NMRBS13340
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80344-NYRBS13340
Крыса Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмидыRG80344-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Syndecan-1 also known as SDC1 and CD138, is the most extensively studied member of the syndecan family. It is found mainly in epithelial cells, but its expression is developmentally regulated during embryonic development. Syndecan-1/SDC1/CD138 has been shown to mediate cell adhesion to several ECM molecules, and to act as a coreceptor for fibroblast growth factors, potent angiogenic growth factors involved also in differentiation. Syndecan-1/SDC1/CD138 expression is reduced during malignant transformation of various epithelia, and this loss correlates with the histological differentiation grade of squamous cell carcinomas, lacking from poorly differentiated tumours. In squamous cell carcinomas of the head and neck, positive syndecan-1 expression correlates with a more favourable prognosis. Experimental studies on the role of Syndecan-1 in malignant transformation have shown that Syndecan-1/SDC1/CD138 expression is associated with the maintenance of epithelial morphology, anchorage-dependent growth and inhibition of invasiveness in vitro.

Ссылки
  • Inki P, et al. (1996) The role of syndecan-1 in malignancies. Ann Med. 28(1): 63-7.
  • Subramanian SV, et al. (1997) Regulated shedding of syndecan-1 and -4 ectodomains by thrombin and growth factor receptor activation. J Biol Chem. 272(23): 14713-20.
  • Park PW, et al. (2001) Exploitation of syndecan-1 shedding by Pseudomonas aeruginosa enhances virulence. Nature. 411(6833): 98-102.
  • Size / Price
    Каталог: RG80344-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».