S100A6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80826-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All S100A6 Reagents

CRO Services

Product recommended


All S100A6 Reagents

S100A6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
270 bp
Description
Full length Clone DNA of Rat S100 calcium binding protein A6 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A6 Background Information

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. S100A6 (S100 calcium binding protein A6) is a member of the S100 family of proteins, and functions in prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of S100A6 have been implicated in melanoma.

Full Name
S100 calcium binding protein A6
References
  • Schäfer, B.W. et al., 1996, Trends Biochem. Sci. 21 (4): 134-140.
  • Donato,R. et al., 2003, Microsc. Res. Tech. 60 (6): 540-551.
  • Nowotny, M. et al., 2003, J. Biol. Chem. 278 (29): 26923-26928.
  • Nonaka D, et al., 2008, J. Cutan. Pathol. 35 (11): 1014-1019.
  • Marenholz, I. et al., 2004, Biochem. Biophys. Res. Commun. 322 (4): 1111-22. 
  • S100A6 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    S100A6 cDNA ORF Clone in Cloning Vector, Rat RG80826-U
    S100A6 cDNA ORF Clone, Rat, untagged RG80826-UT
    S100A6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80826-ACGLN
    S100A6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80826-ACG
    S100A6 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80826-ANG
    S100A6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80826-ACR
    S100A6 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80826-ANR
    S100A6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80826-NF
    S100A6 cDNA ORF Clone, Rat, C-His tag RG80826-CH
    S100A6 cDNA ORF Clone, Rat, N-His tag RG80826-NH
    S100A6 cDNA ORF Clone, Rat, C-HA tag RG80826-CY
    S100A6 cDNA ORF Clone, Rat, N-HA tag RG80826-NY
    S100A6 cDNA ORF Clone, Rat, C-Myc tag RG80826-CM
    S100A6 cDNA ORF Clone, Rat, N-Myc tag RG80826-NM
    S100A6 qPCR Primer Pairs, Rat RP300790

    S100A6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    S100A6 cDNA ORF Clone in Cloning Vector, Mouse MG50229-M
    S100A6 cDNA ORF Clone, Mouse, untagged MG50229-UT
    S100A6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50229-ACG
    S100A6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50229-ACGLN
    S100A6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50229-ACR
    S100A6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50229-CF
    S100A6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50229-NF
    S100A6 cDNA ORF Clone, Mouse, C-His tag MG50229-CH
    S100A6 cDNA ORF Clone, Mouse, N-His tag MG50229-NH
    S100A6 cDNA ORF Clone, Mouse, C-HA tag MG50229-CY
    S100A6 cDNA ORF Clone, Mouse, N-HA tag MG50229-NY
    S100A6 cDNA ORF Clone, Mouse, C-Myc tag MG50229-CM
    S100A6 cDNA ORF Clone, Mouse, N-Myc tag MG50229-NM
    S100A6 qPCR Primer Pairs, Mouse MP200256

    S100A6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    S100A6 cDNA ORF Clone in Cloning Vector, Human HG10939-M
    S100A6 cDNA ORF Clone, Human, untagged HG10939-UT
    S100A6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10939-ACG
    S100A6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10939-ACGLN
    S100A6 cDNA ORF Clone, Human, N-GFPSpark® tag HG10939-ANG
    S100A6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10939-ACR
    S100A6 cDNA ORF Clone, Human, N-OFPSpark® tag HG10939-ANR
    S100A6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10939-CF
    S100A6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10939-NF
    S100A6 cDNA ORF Clone, Human, C-His tag HG10939-CH
    S100A6 cDNA ORF Clone, Human, N-His tag HG10939-NH
    S100A6 cDNA ORF Clone, Human, C-HA tag HG10939-CY
    S100A6 cDNA ORF Clone, Human, N-HA tag HG10939-NY
    S100A6 cDNA ORF Clone, Human, C-Myc tag HG10939-CM
    S100A6 cDNA ORF Clone, Human, N-Myc tag HG10939-NM
    S100A6 qPCR Primer Pairs, Human HP100818
    info info
    添加购物车成功! 添加购物车失败!