Быстрый заказ

Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat S100A16 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001108557.2
Размер кДНК:372bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus S100 calcium binding protein A16 with N terminal Myc tag.
Синоним гена:S100a16
Виды:Rat
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80736-ACGRBS15400
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80736-ACRRBS15400
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80736-ANGRBS15400
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80736-ANRRBS15400
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80736-CFRBS13340
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80736-CHRBS13340
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80736-CMRBS13340
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80736-CYRBS13340
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80736-NFRBS13340
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80736-NHRBS13340
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80736-NMRBS13340
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80736-NYRBS13340
Крыса S100A16 Джин клон кДНК в вектор клонированияRG80736-URBS5130
Крыса S100A16 Джин ORF экспрессии кДНК клона плазмидыRG80736-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

S100A16 is a member of S100 protein super family that carries calcium-binding EF-hand motifs. S100 proteins are cell- and tissue-specific and are involved in many intra- and extracellular processes through interacting with specific target proteins. S100A16 expression was found to be astrocyte-specific. The S100A16 protein was found to accumulate within nucleoli and to translocate to the cytoplasm in response to Ca(2+) stimulation. The homodimeric structure of human S100A16 in the apo state has been obtained both in the solid state and in solution, resulting in good agreement between the structures with the exception of two loop regions. The homodimeric solution structure of human S100A16 was also calculated in the calcium(II)-bound form. Differently from most S100 proteins, the conformational rearrangement upon calcium binding is minor. Immunoprecipitation analysis revealed that S100A16 could physically interact with tumor suppressor protein p53, also a known inhibitor of adipogenesis. Overexpression or RNA interference-initiated reduction of S100A16 led to the inhibition or activation of the expression of p53-responsive genes, respectively. S100A16 protein is a novel adipogenesis-promoting factor.

Ссылки
  • Sturchler E, et al. (2006) S100A16, a novel calcium-binding protein of the EF-hand superfamily. J Biol Chem. 281(50): 38905-17.
  • Liu Y, et al. (2011) Identification of S100A16 as a Novel Adipogenesis Promoting Factor in 3T3-L1 Cells. Endocrinology. 152(3): 903-11.
  • Babini E, et al. (2011) Structural characterization of human S100A16, a low-affinity calcium binder. J Biol Inorg Chem. 16(2): 243-56.
  • Size / Price
    Каталог: RG80736-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».