After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat S100A11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001004095.1
Размер кДНК:297bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus S100 calcium binding protein A11 with N terminal HA tag.
Синоним гена:S100a11
Виды:Rat
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80466-ACGRBS15400
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80466-ACRRBS15400
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80466-ANGRBS15400
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80466-ANRRBS15400
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80466-CFRBS13340
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80466-CHRBS13340
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80466-CMRBS13340
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80466-CYRBS13340
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80466-NFRBS13340
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80466-NHRBS13340
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80466-NMRBS13340
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80466-NYRBS13340
Крыса S100A11 / S100C Джин клон кДНК в вектор клонированияRG80466-URBS5130
Крыса S100A11 / S100C Джин ORF экспрессии кДНК клона плазмидыRG80466-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Protein S100-A11, also known as S100 calcium-binding protein A11, S100A11 and MLN70, is a member of the S-100 family. S100A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S100A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S100A11 would trigger conformational changes which would expose the hydrophobic cleft of S100A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S100A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S100A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S100A11 is also a novel diagnostic marker in breast carcinoma.

Ссылки
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Ohuchida K. et al., 2006, Clin Cancer Res  12 (18): 5417-22.
  • Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.
  • He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.
  • Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.
  • Size / Price
    Каталог: RG80466-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».