RPS3A cDNA ORF Clone, Rat, N-His tag

Cat: RG81289-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All RPS3A Reagents

CRO Services

Product recommended


All RPS3A Reagents

RPS3A cDNA ORF Clone, Rat, N-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Rat ribosomal protein S3a with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS3A Background Information

Full Name
ribosomal protein S3A

RPS3A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPS3A cDNA ORF Clone in Cloning Vector, Rat RG81289-U
RPS3A cDNA ORF Clone, Rat, untagged RG81289-UT
RPS3A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81289-ACGLN
RPS3A cDNA ORF Clone, Rat, C-GFPSpark® tag RG81289-ACG
RPS3A cDNA ORF Clone, Rat, N-GFPSpark® tag RG81289-ANG
RPS3A cDNA ORF Clone, Rat, C-OFPSpark® tag RG81289-ACR
RPS3A cDNA ORF Clone, Rat, N-OFPSpark® tag RG81289-ANR
RPS3A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81289-CF
RPS3A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81289-NF
RPS3A cDNA ORF Clone, Rat, C-His tag RG81289-CH
RPS3A cDNA ORF Clone, Rat, C-HA tag RG81289-CY
RPS3A cDNA ORF Clone, Rat, N-HA tag RG81289-NY
RPS3A cDNA ORF Clone, Rat, C-Myc tag RG81289-CM
RPS3A cDNA ORF Clone, Rat, N-Myc tag RG81289-NM
RPS3A qPCR Primer Pairs, Rat RP301245

RPS3A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS3A cDNA ORF Clone in Cloning Vector, Human HG16468-G
RPS3A cDNA ORF Clone, Human, untagged HG16468-UT
RPS3A cDNA ORF Clone, Human, C-GFPSpark® tag HG16468-ACG
RPS3A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16468-ACGLN
RPS3A cDNA ORF Clone, Human, N-GFPSpark® tag HG16468-ANG
RPS3A cDNA ORF Clone, Human, C-OFPSpark® tag HG16468-ACR
RPS3A cDNA ORF Clone, Human, N-OFPSpark® tag HG16468-ANR
RPS3A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16468-CF
RPS3A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16468-NF
RPS3A cDNA ORF Clone, Human, C-His tag HG16468-CH
RPS3A cDNA ORF Clone, Human, N-His tag HG16468-NH
RPS3A cDNA ORF Clone, Human, C-HA tag HG16468-CY
RPS3A cDNA ORF Clone, Human, N-HA tag HG16468-NY
RPS3A cDNA ORF Clone, Human, C-Myc tag HG16468-CM
RPS3A cDNA ORF Clone, Human, N-Myc tag HG16468-NM
RPS3A qPCR Primer Pairs, Human HP105213
info info
添加购物车成功! 添加购物车失败!