After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat RPLP0 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022402.2
Размер кДНК:954bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ribosomal protein, large, P0 with N terminal HA tag.
Синоним гена:Arbp
Виды:Rat
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80472-ACGRBS15400
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80472-ACRRBS15400
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80472-ANGRBS15400
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80472-ANRRBS15400
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80472-CFRBS13340
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80472-CHRBS13340
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80472-CMRBS13340
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80472-CYRBS13340
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80472-NFRBS13340
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80472-NHRBS13340
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80472-NMRBS13340
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80472-NYRBS13340
Крыса RPLP0 Джин клон кДНК в вектор клонированияRG80472-URBS5130
Крыса RPLP0 Джин ORF экспрессии кДНК клона плазмидыRG80472-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».