After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat RPL10 Информация о продукте «Клон cDNA»
Размер кДНК:645bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ribosomal protein L10 with N terminal Myc tag.
Синоним гена:Rpl10
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80723-ACGRBS15400
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80723-ACRRBS15400
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80723-ANGRBS15400
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80723-ANRRBS15400
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80723-CFRBS13340
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80723-CHRBS13340
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80723-CMRBS13340
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80723-CYRBS13340
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80723-NFRBS13340
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80723-NHRBS13340
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80723-NMRBS13340
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80723-NYRBS13340
Крыса RPL10 Джин клон кДНК в вектор клонированияRG80723-URBS5130
Крыса RPL10 Джин ORF экспрессии кДНК клона плазмидыRG80723-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80723-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.