After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat RNF167 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001008361.1
Размер кДНК:1050bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ring finger protein 167 with C terminal His tag.
Синоним гена:RGD1305972
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81628-ACGRBS15400
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81628-ACRRBS15400
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81628-ANGRBS15400
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81628-ANRRBS15400
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81628-CFRBS13340
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81628-CHRBS13340
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81628-CMRBS13340
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81628-CYRBS13340
Крыса RNF167 Джин клон кДНК в вектор клонированияRG81628-GRBS5130
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81628-NFRBS13340
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81628-NHRBS13340
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81628-NMRBS13340
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81628-NYRBS13340
Крыса RNF167 Джин ORF экспрессии кДНК клона плазмидыRG81628-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81628-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».