Быстрый заказ

Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса RGD1311703 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001013898.2
Размер кДНК:546bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus similar to sid2057p with N terminal HA tag.
Синоним гена:RGD1311703
Виды:Rat
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RGD1311703 qPCR primers for gene expression analysis, RP300432 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80468-ACGRBS22240
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80468-ACRRBS22240
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80468-ANGRBS22240
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80468-ANRRBS22240
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80468-CFRBS20190
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80468-CHRBS20190
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80468-CMRBS20190
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80468-CYRBS20190
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80468-NFRBS20190
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80468-NHRBS20190
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80468-NMRBS20190
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80468-NYRBS20190
Крыса RGD1311703 Джин клон кДНК в вектор клонированияRG80468-URBS5130
Крыса RGD1311703 Джин ORF экспрессии кДНК клона плазмидыRG80468-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80468-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».