After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat RGD1306063 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001106026.2
Размер кДНК:381bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus similar to HT021.
Синоним гена:RGD1306063
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81048-ACGRBS15400
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81048-ACRRBS15400
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81048-ANGRBS15400
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81048-ANRRBS15400
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81048-CFRBS13340
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81048-CHRBS13340
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81048-CMRBS13340
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81048-CYRBS13340
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81048-NFRBS13340
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81048-NHRBS13340
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81048-NMRBS13340
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81048-NYRBS13340
Крыса RGD1306063 Джин клон кДНК в вектор клонированияRG81048-URBS5130
Крыса RGD1306063 Джин ORF экспрессии кДНК клона плазмидыRG81048-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81048-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».