Быстрый заказ

Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса RGD1305743 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001108060.2
Размер кДНК:387bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Mtfp1-like proline rich protein gene with C terminal Flag tag.
Синоним гена:Rcor1
Виды:Rat
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RGD1305743 qPCR primers for gene expression analysis, RP301098 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81141-ACGRBS22240
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81141-ACRRBS22240
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81141-ANGRBS22240
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81141-ANRRBS22240
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81141-CFRBS20190
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81141-CHRBS20190
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81141-CMRBS20190
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81141-CYRBS20190
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81141-NFRBS20190
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81141-NHRBS20190
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81141-NMRBS20190
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81141-NYRBS20190
Крыса RGD1305743 Джин клон кДНК в вектор клонированияRG81141-URBS5130
Крыса RGD1305743 Джин ORF экспрессии кДНК клона плазмидыRG81141-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81141-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».